• Users Online: 175
  • Print this page
  • Email this page

 
Table of Contents
TCM CLINICAL RESEARCH
Year : 2016  |  Volume : 2  |  Issue : 4  |  Page : 55-61

Yiqi-Liangxue recipe improves recovery of injured endothelia by promoting the proliferation and migration of vascular endothelial cells and balancing damage-associated in flammatory mediators


1 China-Japan friendship Hospital
2 Dong Fang Hospital, Beijing University of Chinese Medicine
3 Medical Experimental Center, China Academy of Traditional Chinese Medicine

Date of Submission29-Apr-2016
Date of Acceptance17-Aug-2016
Date of Web Publication10-Sep-2020

Correspondence Address:
Qian Lin
Dong Fang Hospital, Beijing University of Chinese Medicine

Login to access the Email id

Source of Support: None, Conflict of Interest: None


DOI: 10.15806/j.issn.2311-8571.2016.0007

Rights and Permissions
  Abstract 


Aim: Yiqi-Liangxue Recipe (YL) is a compound preparation of Chinese medicine used for preventing cardiovascular events after percutaneous coronary intervention (PCI) (Patent No. 200810240175.4). Maintaining the integrity of endothelia is one of the most effective approaches to prevent restenosis. Given its clinical protective effects on long-term prognosis, we investigated the mechanisms of YL in protecting vascular endothelial cells.
Methods: We prepared drugs serum and human umbilical vein endothelial cell (HUVEC) lines. The injured model was employed with Angiotensin II (Ang II). The YL group was employed with YL treatment. The ARB medicine group was employed with Losartan Potassium treatment. The combination of Chinese medicine and western medicine (YL+ARB) group was employed with both YL and ARB. The control group was unemployed with injury and medical treatment. For each group the cell migration rate (CM) and cell proliferation rate (CP) were measured. The concentration of Nitric Oxide (NO), Reactive Oxygen Species (ROS), Endothelin-1 (ET-1) were assessed. The gene expression level of ET-1 was observed.
Results: YL+ARB group significantly promoted the speed of the CM/CP of the injured HUVECs. Compared with model group, the concentration of NO increased after the drug intervention, and the concentration of ET-1 decreased. Compared with YL+ARB group, YL and ARB group each had the similar weaker effects, but did not have significant difference. The fluorescence of ROS in YL, ARB and YL+ARB group had no difference because the fluorescence was too strong. Compared with model group, the -2AACt values were decreased in the YL, ARB and YL+ARB group. The gene expression level of ET-1 was inhibited after the drug intervention, although with no significant difference. Conclusion: Treatment with YL ameliorates the injury of vascular endothelial cells and YL+ARB has better curative effect. The mechanisms are associated with improving the speed of the CM/CP; increasing the release of NO and attenuating the concentration of damage-associated mediators like ROS, ET-1 and the gene expression level of ET-1. The results suggest that YL maybe an option for preventing cardiovascular events after PCI.

Keywords: Yiqi-Liangxue Recipe, PCI, Vascular endothelial cells, Cell migration, Damage-associated mediators


How to cite this article:
Su F, Cui XY, Sun YN, Lin Q. Yiqi-Liangxue recipe improves recovery of injured endothelia by promoting the proliferation and migration of vascular endothelial cells and balancing damage-associated in flammatory mediators. World J Tradit Chin Med 2016;2:55-61

How to cite this URL:
Su F, Cui XY, Sun YN, Lin Q. Yiqi-Liangxue recipe improves recovery of injured endothelia by promoting the proliferation and migration of vascular endothelial cells and balancing damage-associated in flammatory mediators. World J Tradit Chin Med [serial online] 2016 [cited 2023 Dec 1];2:55-61. Available from: https://www.wjtcm.net/text.asp?2016/2/4/55/294718




  Introduction Top


Cardiovascular disease reported in China 2013 indicated that the prevalence of coronary heart disease (CHD) is increasing year by year in our country[1]. The mortality of PCI in emergency phase is around 4%~6% and many risk factors have the relationship with the cardiovascular events after PCI[2]. In many countries, clinical doctors are now focusing on side effects of PCI such as restenosis and cardiovascular events[3]. Our team in previous researches had found out Yiqi-Liangxue Recipe (YL) can reduce the prevalence of cardiovascular events after PCI and its clinical protective effects on long-term prognosis are significant[4].

The damage of vascular endothelial cell (EC) is the result of stent implantation in PCI and it can induce abnormality of cardiac function and cardiovascular events[5]. In the process of PCI, the continuity of EC in the coronary artery is scratched and the abnormal proliferation of vascular smooth muscle cell (VSMC) appeared. The lesions of tunica intima lead to the release of damage-associated mediators like NO, ROS, ET-1, AT, PEG, and so on. It’s well accepted that traumatic cytokines play an important role in the vascular inflammation and coronary atherosclerosis[6],[7]. Protecting the integrity of endothelium as well as balancing the concentration of damage-associated mediators are considered as essential goals for the treatment of cardiovascular events after PCI.

YL is a compound Chinese medicine according to qi and blood theory, which currently used for preventing cardiovascular events after PCI. The main pharmacological components of it are Salivia, Cortex moutan, Astragalus and Honeysuckle. The clinical application of YL has been used for more than 10 years in dongfang hospital without any side effect. Its potential multiple curative effects make it a possible substitute for therapeutic measures after PCI.


  Methods Top


1. Materials

Twenty two-month-old male rabbits weighing (1.87±0.35) Kg were purchased from Beijing Vital River Animal Technique Limited corporation for the preparation of drugs serum (Certificate No: SCXK 2006-0008). All animals were prepared according to the guidelines of Beijing University of Chinese Medicine. The animals were bred in medical experimental center of China academy of traditional Chinese medicine at (22±2)°C and humidity of 35 ± 5% under a 12-hour light/ dark cycle (Certificate No: SYXK (Jing) 2010-0032).

We selected HUVECs provided by the medical experimental center, China academy of traditional Chinese medicine for experimental cells. All cells were handled according to the guidelines of medical experimental center and were bred in incubator (Thermo, Waltham, MA, USA) at 37°C, 5% CO2 and Saturated humidity.

2. Grouping and Medicine

The rabbits were randomized into a YL group (n=4), an ARB medicine group (n=4), a combination group (YL+ARB, n=4) and a control group (n=4). YL group rabbits were given Yiqi- Liangxue Recipe (produced by Dongfang Hospital, Beijing, China) at a dose of 2.3 g-kg-1-d-1 treatment separately. Rabbits in ARB medicine group were given Losartan Potassium which were purchased by the medicine department of Dongfang Hospital (Merck & Co., Inc., Whitehouse Station, NJ, USA) at a dose of 115 mg-kg-1-d-1 treatment separately. Combination group rabbits were given both YL Recipe and Losartan Potassium (separated about half an hour). Rabbits in control group were given the same volume of 0.9% NaCl separately (purchased by medicine department of Dongfang Hospital). All drugs and 0.9% NaCl administration were performed via gastric twice a day until the end of the 7 days. Abdominal aorta blood sampling under aseptic condition, centrifugation of 1500 r (Bio-Rad, Hercules, CA, USA) for serum and inactivated 30 minutes at 56°C.

HUVECs were randomized into a model group, a YL group, an ARB medicine group, a combination group (YL+ARB) and a control group. Each group was added with separated drug serum.

3. Model Preparation and Drugs Serum Proportion

The model was induced by injecting Angiotensin II. MTT method (Ang II and MTT kits were purchased by Bainuowei Pharmaceutical Co. Ltd; Sigma, St, Louis, MO, USA) was used for selecting the concentration of Ang II (1x10-8, 1x10-7, 1x10-6, 1x10-5, 1x10-4 mol/L) and drugs serum (5%, 10%, 15%, 20%, 25%). The results showed 1x10-6 mol/L Ang II and 15% drugs serum were the best concentration. The model and drugging preparation in five groups were as follows: model group (Ang II+control serum), YL group (Ang II YL serum), ARB medicine group (Ang II+ARB serum), combination group (Ang II+serum of YL+ARB) and control group (control serum and cell culture fluid instead).

4. CCK-8 Method for Cell Proliferation Rate (CP)

HUVECs of stable condition were manually purified by 0.25% trypsin plus 0.04% EDTA (1:1) (Bio-Rad, Hercules, CA, USA) and inoculated to culture plate of 96 holes as 6000/hole. CCK- 8 kits were purchased by Dojindo (Co. Ltd, Japan) for cell proliferation assay. Drugs serum were added after 24 h of cell culture for the five groups (n=5 holes for each group) and CCK-8 solution were added as 10 μL after another 24 h for cell culture incubator. For 1~4 h the plates were tested in enzyme mark instrument as 450 nm for optical density (OD).

5. Live Cell Imaging System for Cell Migration Rate (CM)

HUVECs were inoculated to culture dishes as 1x108/L in cell culture incubator for 24 h and then added drugs serum until overgrow (n=3 dishes for each group). The five groups were given to the cell scratch assay and rinsed 2~3 times in PBS. The HUVECs culture dishes were taken into live cell imaging system (Leica, Oskar-Barnack, Germany) for 12 h imaging and preservation. The cell dynamic migration conditions were recorded and CM of each group was tested. All the images were analyzed by Image Pro Plus 6.0 for analysis.

6. Nitrate Reductase Method for NO Concentration

HUVECs were inoculated to culture plates of 6 holes (n=5 holes for each group) and taken into cell culture incubator for 24 h and then added drugs serum until overgrow. The concentration of NO in cell supernatant of five groups was assayed by nitrate reductase method. The detection of each group was according to the steps of Nitric Oxide assay kits (Jiancheng Pharmaceutical Co. Ltd, Nanjing, China).

7. Fluorescence Probe Method for ROS

HUVECs were inoculated to culture dishes as 1x108/L in cell culture incubator for 24 h and then added drugs serum for five groups (n=5 holes for each group). We added 10 μmol H2DCFH-DA (Sigma, St, Louis, MO, USA) with configuration of serum-free medium as probe. The HUVECs were bred in constant temperature water bath at 37°C and avoided light for 30 minutes. The concentration of ROS was tested by laser scanning confocal microscope (LSCM) after rinsing 2~3 times in serum-free medium.

8. ELISA for ET-1 Concentration

HUVECs were inoculated to culture plates of 6 holes (n=5 holes for each group) and taken into cell culture incubator for 24 h and

9. RT-PCR for Gene Expression Level of ET-1

The RNA of the five groups were extracted (n=5 for each group) and the concentration of RNA was detected as formula = [OD value (260 nm) x40x dilution ratio]/1000. The gene expression levels of ET-1 in five groups were observed by the method of RT-PCR. It contains the reverse transcription of RNA and the polymerase chain reaction. The experimental procedure was according to the manufacture’s instruction of PCR kit (Invitrogen, CA, USA). The RT-PCR primer sequences are as follows:

GAPDH-R (sequence 5’ to 3’): ACGACCAAATCCGTTGACTC. GAPDH-f (sequence 5’ to 3’): CTCTGCTCCTCCTGTTCGAC ET1-R (sequence 5’ to 3’): TCGGTTGTGGGTCACATAACGC ET1-f (sequence 5’ to 3’): ACATTATGGAGAAAGACTGG


  Statistical Analysis Top


All data analyses were carried out by SPSS 17.0 software for Windows (SPSS, Chicago, IL) and parameters were expressed as means ± SD. Statistical analysis was performed using LSD and Bonferroni test of one-way ANOVA, followed by variance analysis for multiple comparisons. A probability of less than 0. 05 was considered to be statistically significant.


  Results Top


1. General Condition

Under microscopy, the HUVECs had typical morphology of EC and took stable condition on glass surface in RPM1640 medium with 10% FBS. The cells had round, spindle shape or irregular shape and had even cytoplasm.

2. YL Accelerating CP

Compared with the model group, YL group and ARB group both significantly enhanced the proliferation of injured endothelial cells and the YL+ARB group had better effects than the two (P<0.05). Each group was diluted into three concentrations as 10000, 5000 and 2500/hole and the cell proliferation curve showed YL+ARB group was statistically significant with others. [Figure 1](a) and [Figure 1](b)


Click here to view


3. YL Accelerating CM

Compared with model group, ARB and YL+ARB group had significantly accelerated CM in 12 h. YL+ARB group was better than ARB group, but YL group showed no significant difference. [Figure 2](a) and [Figure 2](b)


Click here to view


4. YL Increasing the Release of NO

Compared with model group, the content of NO increased after the drug intervention, and YL+ARB group had a statistically significant difference with YL and ARB group (P<0.05).[Figure 3]
Figure 3: The concentration of NO. #P<0.05 vs control group, * P<0.05 vs model group, ▴P<0.05 vs YL and ARB.

Click here to view


5. YL Attenuating the Concentration of ROS, ET-1

The fluorescence of ROS in model group exhibited an obvious difference compared with the control group, but did not have significant difference in YL, ARB and YL+ARB group because the fluorescence was too strong. [Figure 4](a) and [Figure 4](b)


Click here to view


The ELISA results showed significant decreased concentration of ET-1 in YL, ARB, YL+ARB group and YL+ARB group was better than the other two (P<0.05). [Figure 5]
Figure 5: The concentration of ET-1 by ELISA. #P<0.05 vs control group, * P<0.05 vs model group, ▴P<0.05 vs YL and ARB.

Click here to view


6. YL Regulating Gene Expression Level of ET-1

The 2-AACt value of mRNA of ET-1 in model group was correlated with the cell injury. Compared with model group, the 2-AACt values were decreased in the YL, ARB and YL +ARB group. The result means the gene expression level of ET-1 was inhibited after the drug intervention, although with no significant difference. [Figure 6]
Figure 6: The gene expression level 2-ΔΔCt of ET-1.

Click here to view



  Discussion Top


PCI can rapidly alleviate the acute ischemia anoxic condition of coronary artery in CHD patients, but currently there are no effective prophylactic and therapeutic measures to reduce the incidence of long-time cardiovascular events. TCM therapies are on the basis of etiology and pathogenesis and have unique curative effects, which can relieve symptoms, improve ECG effects and reduce recurrence. PCI resulted in the injury of coronary artery endothelia and changes referred to morphological damage, inhibited propagation and abnormal damage-associated mediators, which lead to depress EC protection performance®.

The good cellular growth state of EC is characterized by both normal cell proliferation and cell migration. Many studies are now focusing on the protective barrier functions of EC during the PCI procedure, and the role of the first defending line has been clearly demonstrated®. Many TCM herbs can inhibit the expression of cytokines in EC and result in anti-atherosclerosis effects for CHD patients[10]. A study showed that the Chinese herbs treatment groups improved the cell survival rate and enhanced the CP[11]. The high speed of migration can reduce the structural damage of vascular endothelial cells in PCI, keep integrate state and prevent clinical complications[12]. In this study, the CM and CP were increased in YL+ARB group compared with YL and ARB group. The results showed that the degree of CM and CP were significantly accelerated when treated with YL.

Inhibiting EC injury, coronary artery lesions and clinical adverse cardiovascular events may occur through different mechanisms, and one of these mechanisms may be inhibiting the activation and the release of damage-associated mediators. NO is one of the vasorelaxation factors, which closely related to the cell lesions, and the expression of NO or eNOS can improve the vascular elasticity[13]. ET-1 plays an important part in lipid metabolism and vascular elasticity of EC, as well as pro-inflammatory signaling. ROS is as the second messenger for cell conduction and efficient activation, also results in metabolic disorders. The abnormal emission of damage-associated mediators may lead to disturbance of EC states and atherosclerosis. In this study, the concentration of NO increased after the intervention of drugs serum and YL +ARB group was significant compared with YL and ARB group. YL had also reduced the release of ET-1 and YL+ARB group had better effects of protection. However, the observation outcome of LSCM was not as we expected because the three drug groups did not have therapeutic effects as a successful model. The mechanisms of YL in preventing ROS lesions still need to be investigated furthermore. The present study about the balance of damage-associated mediators after injury demonstrated that YL had direct beneficial effects on the protection of EC and coronary artery.

CHD is as same as “Xiong bi”Xin tong” in TCM theoretical system. Most chronic CHD patients have qi deficiency syndrome in clinical practice and most of the pathogenesis is about qi deficiency and blood stasis with the progress of the disease[14]. YL Recipe (drug composition is Salivia, Cortex moutan, Astragalus and Honeysuckle) is an empirical formula by professor Liao’s qi and blood theory and has already been used in clinical treatment for more than 10 years. In this recipe, Salivia and Cortex moutan cooling and activating blood are the sovereign medicinals of formula and Astragalus tonifying qi is the minister medicinal. Honeysuckle is assistant medicinal, which has heat-clearing and detoxifying effects, also can help removing heat-blood stasis toxisity and increasing the efficacy of other drugs. The compatibility of these four TCM herbs can cool the blood and support the vital energy.

In conclusion, YL has its own unique advantages to avoid cardiovascular events, side effects and improve long-term quality of life for PCI patients in more than 10 years clinical practice. The mechanisms for the function of YL are mainly on the protection of EC, promoting repair, accelerating CP and CM, increasing the release of vascular active substances

NO, reducing the concentration and gene expression level of cell damage factor ET-1 and affecting the content of ROS.


  Limitation Top


As a limitation of this study, it also should be explored from the expression of proteins, like western blot for the expression of some traumatic cytokines. More mechanisms about the protection of YL may be discovered. Furthermore, YL in preventing ROS lesions for EC is still needed to be investigated and other methods can be tried for the study.


  Conclusion Top


According to the traditional Chinese medicine trauma recovery theory, the protective effects of YL on EC and coronary artery are meeting the needs of clinical popularization and application. The mechanisms may partly account for accelerating cell proliferation and cell migration, balancing the concentration of damage-associated mediators like NO, ET-1, etc. The therapy of the combination of Chinese medicine and western medicine has better effect on the damage repair of vascular endothelial cells. On the other hand, as a Chinese herbal compound, the specific mechanisms and therapeutic ingredients of YL still need further investigation.

Biographical note of the first author: Fei Su, female, MD candidate, majoring in Chinese and western medicine combined with prevention and treatment of cardiovascular disease.



 
  References Top

1.
Cardiovascular disease reported in China. Chinese Circulation Journal 2013;29(7): 487-489.  Back to cited text no. 1
    
2.
Xu YF, Ren P. Research progress of risk factors for cardiovascular disease. Chin J Cardiovasc Rehabil Med 2015;24(1): 98-100.  Back to cited text no. 2
    
3.
Zhang XH, Lu ZL, Liu L. Coronary heart disease in China. Heart 2008;94(9): 1126-1131.  Back to cited text no. 3
    
4.
Cui XY. A clinical research on Liangxue Shengji method preventing restenosis and cardiovascular events after percutaneous coronary intervention[D]. Beijing: Beijing university of Chinese medicine, 2007.  Back to cited text no. 4
    
5.
Nong YB, Lin Qi, Wu Y. Effects of blood-cooling and muscle-growing herbs on preventing restenosis and cardiovascular events after percutaneous coronary intervention. China Journal of Traditional Chinese Medicine and Pharmacy 2008;23(2): 161-163.  Back to cited text no. 5
    
6.
Jinno T, Iwai M, Li Z, Li JM, Liu HW, Cui TX, Rakugi H, Ogihara T, Horiuchi M. Calcium channel blocker azelnidipine enhances vascular protective effects of AT1 receptor blocker olmesartan. Hypertension 2004;43(2): 263-269.  Back to cited text no. 6
    
7.
Yokoi H, Daida H, Kuwabara Y, Nishikawa H, Takatsu F, Tomihara H, Nakata Y, Kutsumi Y, Ohshima S, Nishiyama S, Seki A, Kato K, Nishimura S, Kanoh T, Yamaguchi H. Effectiveness of an antioxidant in preventing restenosis after percutaneous transluminal coronary angio- plasty: the Probucol Angioplasty Restenosis Trial. J Am Coll Cardiol 1997;30(4): 855-862.  Back to cited text no. 7
    
8.
Conte MS, VanMeter GA, Akst LM, Clemons T, Kashgarian M, Bender JR. Endothelial cell seeding influences lesion development following arterial injury in the cholesterol-fed rabbit[J]. Cardiovasc Res 2002; 53(2): 502-511.  Back to cited text no. 8
    
9.
Zhang L, Lin L, Li AX. et al. Resveratrol influences the expresstion of NO, eNOS and CAV1 in injured human umbilical vein endothelial cells with homocysteine. Chinese Journal of Laboratory Diagnosis 2014; 18(12): 1923-1925.  Back to cited text no. 9
    
10.
Huan XB, Chen WQ, Wang NQ. et al. Study on protective mechanism of Citrus and Pinellia to the endothelial cell injury. Beijing Journal of Traditional Chinese Medicine 2014;33(11): 868-870.  Back to cited text no. 10
    
11.
Guo CY, Ma XJ, Liu Q et al. Effects of Chinese herbal compound of blood-activating, blood-activating and toxin-dispelling on ox-LDL- induced injury in human umbilical vein endothelial cells. CJTCMP 2014;29(9): 2768-2770.  Back to cited text no. 11
    
12.
Wittchen ES. Endothelial signaling in paracellular and transcellular leukocyte transmigration. Frontiers in Bioscience, 2009, 14(7): 2522-2545.  Back to cited text no. 12
    
13.
Takizawa Y, Kosuge Y, Awaji H, et, al. Up-regulation of eNOS, silent mating SIRT1 and autophagy-related genes by repeated treatments with resveratrol in human umbilical vein endothelial cells[J]. British Journal of Nutrition, 2013;110(12): 1-6.  Back to cited text no. 13
    
14.
Liao JZ, Liu XF, Song CS. et al. Clinical and experimental research on Qi and blood theory of traditional Chinese medicine to guide the treatment of coronary heart disease. Pharmacology and Clinics of Chinese Materia Medica 1986;1: 40-43.  Back to cited text no. 14
    


    Figures

  [Figure 1], [Figure 2], [Figure 3], [Figure 4], [Figure 5], [Figure 6]


This article has been cited by
1 Candesartan ameliorates vascular smooth muscle cell proliferation via regulating miR-301b/STAT3 axis
Ling Zhang,Fan Yang,Qiong Yan
Human Cell. 2020; 33(3): 528
[Pubmed] | [DOI]



 

Top
 
  Search
 
    Similar in PUBMED
   Search Pubmed for
   Search in Google Scholar for
 Related articles
    Access Statistics
    Email Alert *
    Add to My List *
* Registration required (free)  

 
  In this article
Abstract
Introduction
Methods
Statistical Analysis
Results
Discussion
Limitation
Conclusion
References
Article Figures

 Article Access Statistics
    Viewed1373    
    Printed75    
    Emailed0    
    PDF Downloaded62    
    Comments [Add]    
    Cited by others 1    

Recommend this journal